ID: 999475059_999475066

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 999475059 999475066
Species Human (GRCh38) Human (GRCh38)
Location 5:151890836-151890858 5:151890870-151890892
Sequence CCTGGGGGTTATGTTAACAATGC GCCTCAGGAACAAGGTGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 26, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!