ID: 999624538_999624542

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 999624538 999624542
Species Human (GRCh38) Human (GRCh38)
Location 5:153506511-153506533 5:153506528-153506550
Sequence CCAAGCTCCATTTGTTAATTGAG ATTGAGGTGGTTAATTAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 1445} {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!