ID: 999631890_999631892

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 999631890 999631892
Species Human (GRCh38) Human (GRCh38)
Location 5:153579999-153580021 5:153580016-153580038
Sequence CCTCATGTCACATACAGGGAAAC GGAAACAGAGGACCACAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 89, 4: 707} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!