ID: 999712353_999712361

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999712353 999712361
Species Human (GRCh38) Human (GRCh38)
Location 5:154329759-154329781 5:154329781-154329803
Sequence CCTCCCACCCTCTGTGCTTCATC CTGGCGACTCACCAAAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 470} {0: 1, 1: 0, 2: 2, 3: 8, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!