ID: 999722304_999722307

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 999722304 999722307
Species Human (GRCh38) Human (GRCh38)
Location 5:154407806-154407828 5:154407820-154407842
Sequence CCCACTGTGGACTCTTCAGCACT TTCAGCACTCAGGAAGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 181} {0: 1, 1: 0, 2: 0, 3: 40, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!