ID: 999788782_999788783

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 999788782 999788783
Species Human (GRCh38) Human (GRCh38)
Location 5:154917719-154917741 5:154917757-154917779
Sequence CCAAATACTCTCAATGGGCTGAA CTGTAGTTCTCAAAGACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104} {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!