ID: 999957108_999957114

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 999957108 999957114
Species Human (GRCh38) Human (GRCh38)
Location 5:156714585-156714607 5:156714601-156714623
Sequence CCTAAGCCTATGTTTCCCCTAGG CCCTAGGAGCAGTGGCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 86, 4: 321} {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!