ID: 300195847 |
View in Genome Browser |
| Species | Mouse (GRCm38) |
| Location | 1:5083109-5083131 |
| Sequence | TACGAAGTGACAGCAGCGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 57 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 54} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 300195847_300195849 | 3 | Left | 300195847 | 1:5083109-5083131 | CCAGACGCTGCTGTCACTTCGTA | 0: 1 1: 0 2: 0 3: 2 4: 54 |
||
| Right | 300195849 | 1:5083135-5083157 | GTTCCGGCTTCCTCTGAGTGAGG | 0: 1 1: 0 2: 0 3: 1 4: 90 |
||||
| 300195847_300195852 | 22 | Left | 300195847 | 1:5083109-5083131 | CCAGACGCTGCTGTCACTTCGTA | 0: 1 1: 0 2: 0 3: 2 4: 54 |
||
| Right | 300195852 | 1:5083154-5083176 | GAGGCTCGCAACGTCTCCCACGG | 0: 1 1: 0 2: 0 3: 1 4: 38 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 300195847 | Original CRISPR | TACGAAGTGACAGCAGCGTC TGG (reversed) | Intergenic | ||