Disclaimer

We assume no responsibility or liability for any loss or damage incurred as a result of any use of the information contained within or downloaded from this website.

If you have any problems, please let us know


WGE API

Regarding species

Each of the queries below requires a species parameter. This WGE instance accepts the following species:
species Description
Grch38 Human (GRCh38)
Mouse Mouse (GRCm38)

Crispr Search by Region

Find CRISPRs for a given region, returning GFF (for easy displaying in genoverse). A CRISPR will be included in the returned data if and only if its start point chr_start is within the region. I.e. if start <= chr_start <= end.
Required fields: species_id, chr, start, end, assembly
IMPORTANT: This endpoint was originally created for internal use only, but was made public as it proved useful. Unfortunately, this means there are some peculiarities with regards to the interface.
  • The assembly argument is in fact not used, except to set the text between parenthesis in the returned gff file. Thus any non-empty string can be used for this argument. However it IS necessary for the argument to be present, else you'll get an error.
  • To use a specific assembly you can set the species argument to that assembly, e.g. `species_id=Grch38`. Valid arguments for the species_id parameter are currently:
    • Human - which uses the GRCh37 assembly,
    • Mouse - which uses GRCm38,
    • Pig - which uses Sscrofa10.2,
    • Grch38 - which is a more recent human assembly.

https://wge.stemcell.sanger.ac.uk/api/crisprs_in_region?start=35997423&end=35997496&species_id=Mouse&chr=12&assembly=GRCm38
Returns GFF:
##gff-version 3
##sequence-region lims2-region 35997423 35997496
# Crisprs for region Mouse(GRCm38) 12:35997423-35997496
12  WGE Crispr  35997423    35997445    .   +   .   ID=C_349738636;Name=349738636;OT_Summary={0: 1, 1: 0, 2: 3, 3: 25, 4: 292}
12  WGE CDS 35997425    35997445    .   +   .   ID=Cr_349738636;Parent=C_349738636;Name=349738636;color=#45A825
12  WGE CDS 35997423    35997425    .   +   .   ID=PAM_349738636;Parent=C_349738636;Name=349738636;color=#1A8599
12  WGE Crispr  35997445    35997467    .   +   .   ID=C_349738637;Name=349738637;OT_Summary={0: 1, 1: 0, 2: 6, 3: 259, 4: 1774}
12  WGE CDS 35997445    35997465    .   +   .   ID=Cr_349738637;Parent=C_349738637;Name=349738637;color=#45A825
12  WGE CDS 35997465    35997467    .   +   .   ID=PAM_349738637;Parent=C_349738637;Name=349738637;color=#1A8599
12  WGE Crispr  35997457    35997479    .   +   .   ID=C_349738638;Name=349738638;OT_Summary={0: 1, 1: 0, 2: 0, 3: 13, 4: 162}
12  WGE CDS 35997459    35997479    .   +   .   ID=Cr_349738638;Parent=C_349738638;Name=349738638;color=#45A825
12  WGE CDS 35997457    35997459    .   +   .   ID=PAM_349738638;Parent=C_349738638;Name=349738638;color=#1A8599
12  WGE Crispr  35997472    35997494    .   +   .   ID=C_349738639;Name=349738639;OT_Summary={0: 1, 1: 1, 2: 1, 3: 9, 4: 107}
12  WGE CDS 35997472    35997492    .   +   .   ID=Cr_349738639;Parent=C_349738639;Name=349738639;color=#45A825
12  WGE CDS 35997492    35997494    .   +   .   ID=PAM_349738639;Parent=C_349738639;Name=349738639;color=#1A8599
12  WGE Crispr  35997484    35997506    .   +   .   ID=C_349738640;Name=349738640;OT_Summary={0: 1, 1: 0, 2: 1, 3: 5, 4: 85}
12  WGE CDS 35997486    35997506    .   +   .   ID=Cr_349738640;Parent=C_349738640;Name=349738640;color=#45A825
12  WGE CDS 35997484    35997486    .   +   .   ID=PAM_349738640;Parent=C_349738640;Name=349738640;color=#1A8599
12  WGE Crispr  35997490    35997512    .   +   .   ID=C_349738641;Name=349738641;OT_Summary={0: 1, 1: 0, 2: 0, 3: 5, 4: 68}
12  WGE CDS 35997492    35997512    .   +   .   ID=Cr_349738641;Parent=C_349738641;Name=349738641;color=#45A825
12  WGE CDS 35997490    35997492    .   +   .   ID=PAM_349738641;Parent=C_349738641;Name=349738641;color=#1A8599

Off-Targets for Crisprs

Fetch off-target summaries and list of off-target crispr IDs for 1 or more crisprs (up to max of 100).
Required: species, id
https://wge.stemcell.sanger.ac.uk/api/crispr_off_targets?id=1106710989&id=1106710985&species=Grch38
Returns an object mapping crispr ID to its off-target summary and off-target list
{
  "1106710985": {
    "off_targets": [
      904032520,
      904764939,
      ...
      1197488029,
      1199013883
    ],
    "off_target_summary": "{0: 1, 1: 0, 2: 0, 3: 2, 4: 66}",
    "id": 1106710985
  },
  "1106710989": {
    "off_targets": [
      902582231,
      906234136,
      ...
      1188165849,
      1201450411
    ],
    "off_target_summary": "{0: 1, 1: 0, 2: 0, 3: 4, 4: 49}",
    "id": 1106710989
  }
}
            

Off-Targets for Crispr Pairs

Fetch an off-target summary and list of off-target pair IDs for a crispr pair
Required: species, left_id, right_id
where left_id is the CRISPR ID of the left crispr and right_id is the CRISPR ID of the right CRISPR.
Note: this method can be slow (10-20 seconds) if the off-targets for this pair have not been pre-computed
https://wge.stemcell.sanger.ac.uk/api/crispr_pair_off_targets?species=Mouse&right_id=322289791&left_id=322289790
Returns an json string mapping the crispr pair ID to its off-target summary and list of off-target IDs.
{
  "1106711016_1106711017": {
    "off_targets": [
      "1106711016_1106711017"
    ],
    "off_target_summary": "{\"closest\":\"None\",\"total_pairs\":1,\"max_distance\":1000}",
    "id": "1106711016_1106711017"
    }
}

Find Crispr ID for Sequence

Find a CRISPR ID for a given gRNA
Required fields: seq, species, pam_right
pam_right can be set to the following values:
  • 0 - only find crisprs on the global negative strand
  • 1 - only find crisprs on the global positive strand
  • 2 - search in both orientations
Optionally, get_db_data can be set to 1 to return the crispr data for each ID found
https://wge.stemcell.sanger.ac.uk/api/search_by_seq?species=Mouse&pam_right=2&seq=GTCCCCAGAATTGTGTTTGT
Returns a list of IDs that matched:
[349738765]
Or, with get_db_data set to 1 a list of CRISPRs:
[
   {
      "chr_start":35998625,
      "off_target_summary_arr":[
         "1",
         "0",
         "0",
         "10",
         "155"
      ],
      "pam_right":1,
      "species_id":2,
      "exonic":1,
      "chr_end":35998647,
      "id":349738765,
      "off_target_summary":"{0: 1, 1: 0, 2: 0, 3: 10, 4: 155}",
      "genic":1,
      "chr_name":"12",
      "seq":"GTCCCCAGAATTGTGTTTGTAGG"
   }
]

Find Off-Targets for Sequence

Fetch off-target summary and list of off-target crispr IDs for any 20bp sequence.
Required fields: seq, species, pam_right
pam_right must be set to 'true' or 'false'
https://wge.stemcell.sanger.ac.uk/api/off_targets_by_seq?seq=TTAATTGGTCAGCCTAACTC&species=mouse&pam_right=false
Returns off-target summary and off-target list. If a CRISPR site is found in the genome that exactly matches the search sequence then the ID of this is given. If there are multiple exact matches then the ID is that of the first match. If no exact match is found in the genome the ID returned will be 0.
{
"off_targets": [
302072111,
310736349,
310901261,
320182042,
456345367,
...
],
"off_target_summary": "{0: 1, 1: 0, 2: 0, 3: 6, 4: 48}",
"id": 456345367
}
            

Find Crispr Sequence by ID

Fetch Crispr sequence for 1 or more crispr IDs.
Required: species, id
https://wge.stemcell.sanger.ac.uk/api/crispr_seq_by_id?id=1106710999&id=1106711006&species=Grch38
Returns an JSON containing the crispr sequence:
{
  "1106711006":
    {
      "seq":"GCCATTAAATGAGGAAACAGTGG"
    },
  "1106710999":
    {
      "seq":"CCTATTGCATATTTCTTCATGTG"
    }
}

Find Crispr by ID

Fetch Crispr information and an off-target summary for 1 or more crispr IDs.
Required: species, id
https://wge.stemcell.sanger.ac.uk/api/crispr_by_id?id=1106710999&id=1106711006&species=Grch38
Returns an JSON containing the crispr:
{
  "1106711006":
    {
      "chr_start":32332849,
      "pam_right":1,
      "species_id":4,
      "exonic":1,
      "chr_end":32332871,
      "id":1106711006,
      "off_target_summary":"{0: 1, 1: 0, 2: 1, 3: 30, 4: 301}",
      "genic":1,
      "chr_name":"13",
      "seq":"GCCATTAAATGAGGAAACAGTGG"
    },
  "1106710999":
    {
      "chr_start":32332714,
      "pam_right":0,
      "species_id":4,
      "exonic":1,
      "chr_end":32332736,
      "id":1106710999,
      "off_target_summary":"{0: 1, 1: 0, 2: 3, 3: 46, 4: 563}",
      "genic":1,
      "chr_name":"13",
      "seq":"CCTATTGCATATTTCTTCATGTG"
    }
}
            


WGE Components

(A) The WGE website (with the genoverse genome browser) presents pre-computed CRISPR and off-target data from the WGE Database (B) as well as Ensembl gene structure and variation data (C), and user-generated targeting vector designs (D). CRISPR location data for the whole genome is pre-computed in WGE. Off-target data is precomputed for all CRISPRS in the exome (E) and stored in WGE (F). Off-target data which has not been pre-computed can be requested from the website (G) and is stored in WGE (H) and displayed as usual (B).


CRISPR-Analyser

To calculate off targets for CRISPRs we use the CRISPR-Analyser package, hosted here: CRISPR-Analyser on github
The CRISPR-Analyser works as follows: (A) Any Genome is scanned for all possible CRISPR sites (1,2,3…), and the resulting sequences (B) are stored as a CSV file. (C) Each CRISPR sequence in the file is converted to a 64 bit integer and the resulting index kept in-memory is a Mongoose server. All targets for a specific query-CRISPR string (D) are matched against every possible genomic crispr site using a rapid XOR (E) and the resulting possible Off-target sites returned as a list (F), along with the number of mismatches to the possible off-target site.


Source code

Our web application is written in Perl using the Catalyst framework. The application runs on a PostgreSQL database.
The code can be seen in our github repository

This tool is being continuously developed and extended. If you wish to contact us about it, please do so at wge@sanger.ac.uk