ID: 981137078_981137081

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 981137078 981137081
Species Human (GRCh38) Human (GRCh38)
Location 4:141222474-141222496 4:141222503-141222525
Sequence CCATGTAATGCCTCAATGGTATC TTTTGATATCAGTTGGTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81} {0: 1, 1: 0, 2: 0, 3: 15, 4: 191}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
6 4:141222474-141222496 CCATGTAATGCCTCAATGGTATC - 4:141222503-141222525 TTTTGATATCAGTTGGTAGTTGG +