ID: 1000935619_1000935622

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1000935619 1000935622
Species Human (GRCh38) Human (GRCh38)
Location 5:167301250-167301272 5:167301265-167301287
Sequence CCGATTTTTCAGTGGGGTCCCAC GGTCCCACACAGATGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 120} {0: 82, 1: 298, 2: 258, 3: 133, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!