ID: 1001009205_1001009213 |
View in Genome Browser |
Spacer: 9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1001009205 | 1001009213 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:168083038-168083060 | 5:168083070-168083092 |
| Sequence | CCTGCCCCCGAGGTGGAGTCTAC | AAGGCCTCCTTGAGCTGCAGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 337, 2: 649, 3: 3781, 4: 1551} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||