ID: 1001777119_1001777126

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1001777119 1001777126
Species Human (GRCh38) Human (GRCh38)
Location 5:174337300-174337322 5:174337331-174337353
Sequence CCAAGTAGATTTGCGCCAAGTGT ATGTGGCAGAGAGAACTTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!