ID: 1002163084_1002163089

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1002163084 1002163089
Species Human (GRCh38) Human (GRCh38)
Location 5:177328320-177328342 5:177328334-177328356
Sequence CCTGGGGAAACCCAGAGGAACTG GAGGAACTGGAGGCCCTCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!