ID: 1002266339_1002266342

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1002266339 1002266342
Species Human (GRCh38) Human (GRCh38)
Location 5:178036635-178036657 5:178036660-178036682
Sequence CCATGTCAGAGAGTCCTTAGCAT ATGTGTATGTGGAAGTATGTTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 0, 3: 4, 4: 97} {0: 3, 1: 0, 2: 4, 3: 59, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!