ID: 1002296217_1002296228

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1002296217 1002296228
Species Human (GRCh38) Human (GRCh38)
Location 5:178232684-178232706 5:178232727-178232749
Sequence CCCCGAAGCGCCCGCGTTGCGGT CACTGGGCCTGGCAGCCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15} {0: 1, 1: 0, 2: 4, 3: 42, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!