ID: 1002313972_1002313986

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1002313972 1002313986
Species Human (GRCh38) Human (GRCh38)
Location 5:178331542-178331564 5:178331577-178331599
Sequence CCAAGGAATCCGCGGCCCTCGGG GCAGGGAGGGCGAGGCTCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 53, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!