ID: 1002313980_1002313990

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1002313980 1002313990
Species Human (GRCh38) Human (GRCh38)
Location 5:178331558-178331580 5:178331602-178331624
Sequence CCTCGGGGCAGGGTGCGGAGCAG AGAGGCAGCCACCGACAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 31, 4: 291} {0: 1, 1: 0, 2: 2, 3: 17, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!