ID: 1002452375_1002452383

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1002452375 1002452383
Species Human (GRCh38) Human (GRCh38)
Location 5:179326242-179326264 5:179326274-179326296
Sequence CCGGGCAGCTGCCCCAGGAATGC GGGAAGAGCTAGAGGACCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!