ID: 1002452381_1002452387

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1002452381 1002452387
Species Human (GRCh38) Human (GRCh38)
Location 5:179326255-179326277 5:179326294-179326316
Sequence CCAGGAATGCTGTATTGGCGGGA TGGCCTCAGCCATGTCCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 25, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!