ID: 1002452381_1002452388

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1002452381 1002452388
Species Human (GRCh38) Human (GRCh38)
Location 5:179326255-179326277 5:179326295-179326317
Sequence CCAGGAATGCTGTATTGGCGGGA GGCCTCAGCCATGTCCTGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 21, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!