ID: 1002887881_1002887895

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002887881 1002887895
Species Human (GRCh38) Human (GRCh38)
Location 6:1312226-1312248 6:1312272-1312294
Sequence CCCCCACGGTGGCACGCACATCA AAGACGCCCGCGCGGGACCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!