ID: 1002887891_1002887901

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1002887891 1002887901
Species Human (GRCh38) Human (GRCh38)
Location 6:1312267-1312289 6:1312298-1312320
Sequence CCCCGAAGACGCCCGCGCGGGAC GCCAGTGAAGAACCCCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25} {0: 1, 1: 0, 2: 3, 3: 11, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!