ID: 1003081713_1003081724

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1003081713 1003081724
Species Human (GRCh38) Human (GRCh38)
Location 6:3026592-3026614 6:3026635-3026657
Sequence CCTCAGTCCTGTCAGGAGAAACC AGGAGCTTGAAATCCTGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 190} {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!