ID: 1003081719_1003081727

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1003081719 1003081727
Species Human (GRCh38) Human (GRCh38)
Location 6:3026618-3026640 6:3026651-3026673
Sequence CCCACTAGAATCCCAGGAGGAGC GTCTGGGATCCTGACGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 108} {0: 1, 1: 0, 2: 3, 3: 9, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!