ID: 1003098174_1003098196

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003098174 1003098196
Species Human (GRCh38) Human (GRCh38)
Location 6:3157860-3157882 6:3157897-3157919
Sequence CCGAGCCGCCCACTCTGGACCCC GACCGGGGGCCCCGGAACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!