ID: 1003317846_1003317860

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1003317846 1003317860
Species Human (GRCh38) Human (GRCh38)
Location 6:5027798-5027820 6:5027850-5027872
Sequence CCTGGAGACAACAGGACCGGTGG AAGTGCCCCGGGCTGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!