ID: 1003319627_1003319633

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1003319627 1003319633
Species Human (GRCh38) Human (GRCh38)
Location 6:5038838-5038860 6:5038862-5038884
Sequence CCTTGGCTCGGCATCAGAGGGAG CCGCGGAAGGAGACCGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 3, 3: 4, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!