ID: 1003499431_1003499437

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1003499431 1003499437
Species Human (GRCh38) Human (GRCh38)
Location 6:6692100-6692122 6:6692123-6692145
Sequence CCTCTAGCTGTTCCACCCAGGGC CTCTGGCCTGTCCTTTCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147} {0: 1, 1: 0, 2: 1, 3: 41, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!