ID: 1003556032_1003556053

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1003556032 1003556053
Species Human (GRCh38) Human (GRCh38)
Location 6:7141129-7141151 6:7141182-7141204
Sequence CCCCTCGGGCCGCCCCCAGGGCT GAGGCCATCAGTCAGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 272} {0: 1, 1: 0, 2: 2, 3: 19, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!