ID: 1003556044_1003556050

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1003556044 1003556050
Species Human (GRCh38) Human (GRCh38)
Location 6:7141152-7141174 6:7141175-7141197
Sequence CCCGCGGTGGGTGTCCGGTGAGC GGGTAGCGAGGCCATCAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!