ID: 1003556055_1003556060

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1003556055 1003556060
Species Human (GRCh38) Human (GRCh38)
Location 6:7141186-7141208 6:7141205-7141227
Sequence CCATCAGTCAGGGCGGCGGGCGC GCGCCGATTGGCTGGCGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72} {0: 1, 1: 1, 2: 1, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!