ID: 1003556055_1003556074

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1003556055 1003556074
Species Human (GRCh38) Human (GRCh38)
Location 6:7141186-7141208 6:7141231-7141253
Sequence CCATCAGTCAGGGCGGCGGGCGC GGGCCGGGCGGGGCGGGGCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 18, 2: 293, 3: 1046, 4: 3508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!