ID: 1003559679_1003559697

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1003559679 1003559697
Species Human (GRCh38) Human (GRCh38)
Location 6:7170389-7170411 6:7170442-7170464
Sequence CCTCACTGCCCAGGAGCAGCAGA GAATCCTGGCTGAAGGGCTCAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 4, 3: 64, 4: 529} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!