ID: 1003791218_1003791221

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1003791218 1003791221
Species Human (GRCh38) Human (GRCh38)
Location 6:9549967-9549989 6:9550001-9550023
Sequence CCATCTTCTGAAGATAACTACTC GACAGCTCTTGGCCTATTACTGG
Strand - +
Off-target summary No data {0: 17, 1: 183, 2: 194, 3: 123, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!