ID: 1004065310_1004065315

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1004065310 1004065315
Species Human (GRCh38) Human (GRCh38)
Location 6:12238330-12238352 6:12238353-12238375
Sequence CCAGTCCCTGTCCCAGTGGAGTC ATTTCTCAAGTCCTGCGTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!