ID: 1004420516_1004420521

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1004420516 1004420521
Species Human (GRCh38) Human (GRCh38)
Location 6:15465335-15465357 6:15465351-15465373
Sequence CCCAGCTACAGGAGGCTGAGGTG TGAGGTGGGAGGATCACTTGTGG
Strand - +
Off-target summary {0: 16, 1: 30, 2: 124, 3: 296, 4: 733} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!