|
Left Crispr |
Right Crispr |
| Crispr ID |
1004420516 |
1004420522 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:15465335-15465357
|
6:15465356-15465378
|
| Sequence |
CCCAGCTACAGGAGGCTGAGGTG |
TGGGAGGATCACTTGTGGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 17, 1: 2154, 2: 17286, 3: 55661, 4: 126572} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|