|
Left Crispr |
Right Crispr |
| Crispr ID |
1004420516 |
1004420524 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:15465335-15465357
|
6:15465365-15465387
|
| Sequence |
CCCAGCTACAGGAGGCTGAGGTG |
CACTTGTGGCCAGGAGGTCGAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 33, 2: 1140, 3: 8633, 4: 33413} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|