ID: 1004669196_1004669203

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1004669196 1004669203
Species Human (GRCh38) Human (GRCh38)
Location 6:17779827-17779849 6:17779854-17779876
Sequence CCCCCTGGGGTTCACACCATTCT CCTCAGCCTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212} {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!