ID: 1004947268_1004947275

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1004947268 1004947275
Species Human (GRCh38) Human (GRCh38)
Location 6:20629750-20629772 6:20629774-20629796
Sequence CCCTGTGCTGGTTGCCCCCTGTA AGATGCCCCATGTTCTTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!