ID: 1005051251_1005051256

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1005051251 1005051256
Species Human (GRCh38) Human (GRCh38)
Location 6:21685874-21685896 6:21685926-21685948
Sequence CCAAGCTTCATCTGTGTTTACAG AGCTCCATCTTCTGTCAGATCGG
Strand - +
Off-target summary {0: 4, 1: 12, 2: 19, 3: 26, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!