ID: 1005072455_1005072467

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1005072455 1005072467
Species Human (GRCh38) Human (GRCh38)
Location 6:21874445-21874467 6:21874481-21874503
Sequence CCTGCGCCTGGAAACAGACTCGG TATCAGGGCAGGGGGCATGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!