ID: 1005681949_1005681958

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1005681949 1005681958
Species Human (GRCh38) Human (GRCh38)
Location 6:28216913-28216935 6:28216957-28216979
Sequence CCCCACAACCTCTGCCCCAGGGA GAAAAGGCCATATGCATCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 465} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!