ID: 1005992817_1005992825

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1005992817 1005992825
Species Human (GRCh38) Human (GRCh38)
Location 6:30914127-30914149 6:30914166-30914188
Sequence CCGTGGGGTTTGCCTTCGCGGCG CTACAGCCTTTGGACCGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 27} {0: 1, 1: 0, 2: 1, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!