ID: 1005992819_1005992821

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1005992819 1005992821
Species Human (GRCh38) Human (GRCh38)
Location 6:30914139-30914161 6:30914156-30914178
Sequence CCTTCGCGGCGGACTCGCTCCTC CTCCTCTGGTCTACAGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48} {0: 1, 1: 0, 2: 1, 3: 25, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!