ID: 1006001553_1006001558

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1006001553 1006001558
Species Human (GRCh38) Human (GRCh38)
Location 6:30969047-30969069 6:30969086-30969108
Sequence CCTGCCATCTTCTGCAGATAACT ACAGCTCTTGGCCTATTACTGGG
Strand - +
Off-target summary No data {0: 16, 1: 194, 2: 203, 3: 147, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!