|
Left Crispr |
Right Crispr |
| Crispr ID |
1006024204 |
1006024207 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:31137116-31137138
|
6:31137154-31137176
|
| Sequence |
CCAGCCTGGGCATAGAGTGAGAC |
AAGAAAGAAAAAGAAGAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 140, 2: 838, 3: 7218, 4: 13193} |
{0: 3, 1: 37, 2: 416, 3: 2558, 4: 17623} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|