ID: 1006054954_1006054961

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1006054954 1006054961
Species Human (GRCh38) Human (GRCh38)
Location 6:31377460-31377482 6:31377478-31377500
Sequence CCTACTTCTGATCCCCTAGGACT GGACTGGGAGCAGCCCGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150} {0: 1, 1: 0, 2: 0, 3: 20, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!