ID: 1006151475_1006151478

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1006151475 1006151478
Species Human (GRCh38) Human (GRCh38)
Location 6:31992382-31992404 6:31992404-31992426
Sequence CCAGCTGGAGCTCAGCGTGGACG GGTGCCAAGCAGTACCGGAACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 27, 4: 690} {0: 2, 1: 0, 2: 0, 3: 2, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!